September 2008
Slave mentality Whenever I write anything criticizing the Chinese
government I get a scattering
of emails like this one from people with Chinese surnames. The forenames are invariably male.
Mr Derbyshire — The fireworks 'fakery' [i.e. at the Olympics opening ceremony, which I had written about] was nothing. The fireworks were there but they found it difficult to film. No different from the arrow which lit the torch at Athens. Whats more the Chinese did not try to hide this at all — nor did they hide the lip synching. Contrast this with the Australians had their orchestra mime their performance at Sydney. Whats more they gagged the performers — making them sign a confidentiality agreement.
All this nit-picking is just resentful westerners bitter at the rise of a non-white nation. But at least the Western media beatup awakens more Chinese people to the hatred that exists for them in the West.
The fact is the Chinese goverment is more popular than ever before, as a recent Pew research poll has shown. This matches my personal experience.
In fact most Chinese I know, even those in Hong Kong where I live, were angry with the government for not coming down more harshly with the Tibetans.
And the Olympic games, I would wager were the most popularly supported of all time.
My reactions to these sneering little epistles are multifold.
- If the ChiComs are so darn popular, why don't they confirm their popularity by holding an election, as governments do in other modern nations? That would kill once and for all the annoying Western carping about legitimacy.
- If Chinese people want to live down the old "slave mentality" canard, a good start would be to stop expressing satisfaction with leaders who have elected themselves. Citizens of free nations prefer to have some say in the matter.
- I don't know of any Westerner who is "bitter at the rise of a non-white nation." I don't, for example, recall a single instance of anyone expressing bitterness to me at the rise of India, Malaysia, or Taiwan. I do, though, know quite a lot of people who worry about the rise of a bloodstained dictatorship, many of whose young males express the aggrieved racial resentment of correspondents like that one, and their obvious, fascistic admiration for unrestrained despotic power.
This month's most defiantly moronic assertion of
blank
slate
orthodoxy "I believe that given the opportunity, most people could do most
anything." —
New York Times reporter Deborah
Solomon, interviewing Charles
Murray about his new book
Real
Education.
Silly-clever I mentioned in The Corner that I
have been reading books of
religious —
so far, only Christian — apologetics. That brought in more email than the average ten comments about
politics. Yes, my purpose here is
subversive. I have the vague idea of writing a sort of vade mecum for the conservative unbeliever. "Why should
the Devil have all the best
tunes?" asked William Booth. Well, why should the Left have all the good hearty atheist manifestoes? American
liberalism and American
conservatism have both in turn been debauched by presidents filled with religious zeal (J. Carter and G.W. Bush
respectively). Perhaps atheism
may yet be the salvation of the Republic.
Far and away the most enjoyable — since I am at odds with the subject matter, I suppose in honesty I should say "least unenjoyable" — apologetic I have read so far is Paul Johnson's. I am tempted to say that any believers out there who feel like writing a book of apologetics should imitate P.J.'s approach, if they want to make any impression on the unbelieving reader. (Which I suspect very few of them actually do want to do …)
There is no point in saying this though, because to follow in P.J.'s footsteps, you'd need to have a mind as well furnished as his; and very, very few of us have that. The joy of reading P.J. is the odd little factlets he throws out on every page from his capacious and densely-stocked memory. Did you know that the Duke of Wellington's funeral carriage "was of cast-iron, weighed 20 tons and can still be seen in the crypt of St. Paul's cathedral"?** Or that "After the Book of Job, [God] scarcely speaks ever again … He becomes a silent God." Or that there was a fashion among English artists of the eleventh century to portray the Ascension with only the legs and feet of Christ showing, the rest of him having disappeared into the cloud (Acts 1.ix)?
So did P.J. come close to converting me? Good grief, no. He left me feeling sad, in fact, that so much erudition and brilliance should have put itself in service to such rank superstition. There is nothing indirect or hesitant about P.J.'s Christianity, no wishy-washy kind'n'gentle hell-is-empty equivocation. This is pure Baltimore Catechism fire and brimstone. P.J.'s hell is real, painful, and most likely (he leaves himself an out here, but it looks like a perfunctory afterthought) well-populated. I'm headed there myself, according to P.J.:
To become Hell-fodder, a soul must have a pronounced and ineradicable streak of arrogance …
Oh dear. P.J. softens a little when writing of St. Thomas Aquinas's much-derided suggestion in Summa Theologica that one of the pleasures of Heaven is watching the damned suffer in Hell: "… as if happy souls parade on a sort of celestial balcony to watch the devils prodding and incinerating the damned down below." It's all much more subtle than that, says P.J. Is it? I must say, if I could bring myself to believe in any of this afterlife business, the prospect of making it to that balcony would be exactly the thing to get me down on my knees praying to be saved.
P.J. has the eschaton figured out in fine detail:
Judgment Day is quite a complicated affair. Correction: it is an infinitely complicated affair, involving literally billions of people. In addition to the masses of souls involved, there is the added complication that they are divided into two main groups, each subdivided into three. The two main groups are those who have already been dealt with at their Particular Judgments, spread over thousands of years … and those still on earth when it comes to an end, whose Particular Judgment is telescoped into the General Judgment …
It sounds worse than the lifeboat drill they put you through at the start of a cruise. "If you have a green tag, you want to be over at the other side of the ship …" One thing you have to concede to atheists: our afterlife is a whole lot simpler. As an unbeliever friend of mine likes to say: "Things get real quiet."
For an unbeliever, though, most apologetics is thin and dreary stuff. Thinnest and dreariest of all so far was the book all my Christian friends told me I must read, C.S. Lewis's Mere Christianity. Do people really take Lewis seriously on religion? He had a superb imaginative gift — the Narnia books are delightful, except the last, which I thought over the top, and which baffled my kids when I read it to them. People who know these things tell me Lewis was a first-class literary critic, too. In fact, with the Milton quadricentenary coming up, a friend tells me that Lewis's book on Milton is a classic, a must-read. (I have so far got no further in paying my respects to the great poet than listening to Prof. Lerer's Teaching Company lectures.)
I can't speak to Lewis's literary criticism, but having now sampled both his fantasy fiction and his apologetics, I'd have to say that there strikes me as something disconcertingly childlike about the man, some way in which he never grew up. This particular human defect is just what you want in a writer of fantasy, of course — the other Lewis (Carroll) being the star exhibit here. It is fatal to anyone writing about religion, though, as the childlike side of religious belief — the wishful thinking, the misplaced logic, the unworldliness — is exactly what a writer of apologetics should steer away from if he wants to appeal to adults.
In Lewis's case the result is particularly unappetising, threadbare and paltry arguments delivered in a tone that is irritating beyond endurance. Just compare Lewis on sex (Chapter III.5) with P.J. (Chapter 5). Lewis: "I know some muddle-headed Christians have talked as if Christianity thought that sex, or the body, or pleasure, were bad in themselves. But they were wrong. Christianity is almost the only one of the great religions which thoroughly approves of the body …" (There are certain Hindu temples I should like to have taken Lewis to see.) P.J.: "Sex among human beings is … a rival to God, often a successful rival. The church is sensible to take it with the utmost seriousness." Nothing "muddle-headed" about P.J.'s faith.
I'm glad to see myself in good company here. In his "As I Please" column for October 27, 1944, George Orwell wrote about Lewis's book Beyond Personality, which ended up as Book IV of Mere Christianity. Orwell couldn't stand Lewis's gay-scoutmaster style either. This was in fact the occasion of Orwell's blast at what he called the "silly-clever" type of religious apologetics:
A kind of book that has been endemic in England for quite sixty years is the silly-clever religious book, which goes on the principle not of threatening the unbeliever with Hell, but of showing him up as an illogical ass, incapable of clear thought and unaware that everything he says has been said and refuted before … The line of attack is always the same. Every heresy has been uttered before (with the implication that it has also been refuted before); and theology is only understood by theologians (with the implication that you should leave your thinking to the priests). Along these lines one can, of course, have a lot of clean fun by "correcting loose thinking" and pointing out that so-and-so is only saying what Pelagius said in a d 400 (or whenever it was), and has in any case used the word transsubstantiation in the wrong sense …
Footnote to all that: I note that P.J. and Orwell both capitalize "Hell." WFB did too; there is a witty aside about that in Nearer My God. Yet Milton, whom I mentioned up above there somewhere, doesn't, not at any rate in the Cambridge University Press edition of Paradise Lost, which I have always supposed to be definitive.
Say first, for heaven hides nothing from thy view
Nor the deep tract of hell, say first what cause
Move our grand parents in that happy state,
Favoured of heaven so highly, to fall off
From their Creator …
Shouldn't Milton be the ultimate authority here? If he didn't capitalize "Hell," why should I? ("Usually lowercased" says The New York Public Library Writer's Guide to Style and Usage … but everyone goes by that damn Chicago thing that I don't have. Who cares about bloody Chicago?)
I've gone on too long about this, haven't I? I'll stop.
** A reader supplies the following: "The carriage is at Stratfield Saye (the home of the present Duke of Wellington), and seems to weigh 18 tons according to most sources, except St Pauls' own site which claims 12! While the carriage was at the cathedral it has long since been moved. The 1st Duke is though buried in the crypt of St. Pauls.
Harris on Palin Actually, I'll segue off that to Celebrity Atheist
Sam Harris's attack on Sarah Palin in the September 20 issue of
Newsweek. Sam objects to
Sarah's religious views of course, but it was this other point that got my attention:
The next administration must immediately confront issues like nuclear proliferation, ongoing wars in Iraq and Afghanistan (and covert wars elsewhere), global climate change, a convulsing economy, Russian belligerence, the rise of China, emerging epidemics, Islamism on a hundred fronts, a defunct United Nations, the deterioration of American schools, failures of energy, infrastructure and Internet security … the list is long, and Sarah Palin does not seem competent even to rank these items in order of importance, much less address any one of them.
That is elitism run amok. Who on earth has the expertise to cope knowledgably with all those issues? Even to reach Sam's standard, you could put together a roomful of the smartest people in the U.S.A., and I doubt they'd agree on an importance ranking.
We're not electing a philosopher-king, we're electing an administrator, someone with good common sense and sound judgment. We've tried Wonder Boys in the presidency, and they didn't work out too well. Herbert Hoover, anybody? (With Paul Johnson still in mind, recall how in Modern Times he tagged Hoover with Tacitus's verdict on the emperor Galba: omnium consensu capax imperii nisi imperasset — "by general consent fit to rule, had he not ruled.") Or how about Jimmy Carter, an exceptionally clever, capable, and accomplished man? On the other side there is Harry Truman, who was scoffed at in much the sames terms Harris uses against Palin.
The question who will, and who will not, make a good president is more mysterious than the disposition of souls in the afterlife. The poor voter can do little better than go with the candidate whose broad outlook on public affairs matches his own. As to intelligence, education, and ability — well, so long as my candidate, thus selected, doesn't actually drool or fall down in public, I'll rest my hopes in him/her doing at least better than Hoover and Carter, perhaps even as well as Truman. (Who, by the way, was my father's favorite U.S. President, for reasons I have forgotten.)
And the real lesson here is surely a conservative one: Since, given the number and scale of the issues they face, it is not likely that much of what they do will be right, the less we allow them to do, the better. Left alone, most problems take care of themselves.
Charles Hurt, writing in America's Newspaper of Record on September 29, struck a chord that should resonate in the breast of every true conservative:
The reason Americans endure their federal government is that it is so inept and useless that it has little bearing on their everyday lives. But in an economic meltdown like this, people don't have a choice but to feel the fallout of their government's incompetence …
Exactly. Washington DC is populated by fools and rogues. The less power we give them, the better. Yet we keep on giving them more! Perhaps we are fools, too.
Mind science book of the month Still chewing my way through a long
booklist I assembled after
that mind science conference I blogged on back in
April. This month I read a gem: Jeff Hawkins' 2004 book
On
Intelligence,
which is nothing to do with IQ, but offers a good practical model of how the brain works. I've read bits and pieces of
this in other books and
science-mag articles, but Hawkins, who is founder of the Redwood Neuroscience Institute as well as a successful
computing entrepreneur, puts it
altogether very cogently.
Sexiest voice Well, who's got it? The sexiest singing voice, that is.
Trying this question out on
friends I got some unexpected answers: Edith Piaf (come on: if she had sung in English, would you have
thought her sexy?); Emmylou
Harris (way easy on the eye back in her prime, I'll agree, but the voice? hmmm); Julie London (from Mike
Potemra, that, and a penetrating
suggestion — gonna have to consider it); Rod Stewart (for goodness sake!) …
Well, here's my vote: Doris Day. Off the wall, I know; but here's how I got to thinking about it. In the September issue of Literary Review, Christopher Bray reviews two recent biographies of Ms. Day (originally Doris Kappelhoff, and still with us, aged 86). Bray's review includes the following:
[W]hat marked her out, as her talent grew, was the orgasmic tremor that fired her long, glowing phrases. She could bend every note till it was hangdog with heartache, but she never sounded sorry for herself. Listen again to "Secret Love" from Calamity Jane, to the title song of Move Over, Darling, or to anything from Duet (the piano and voice album she made with André Previn in the early Sixties), and try gainsaying [bandleader Les] Brown's claim that "next to Sinatra, Doris is the best in the business on selling a lyric"
I'll go along with that, if only because, ever since reading the review, those first two songs have been playing in my head on permanent loops. Does anyone know how to switch these things off?
World's most out-of-print book? In conversation with
some friends I mentioned Peter
Kemp,
the young Englishman who went off to fight for Franco in the Spanish Civil War and wrote a fine book about the
experience, title Mine Were of
Trouble. In spite of being badly wounded in Spain — half his jaw was blown off by a hand grenade; his
comrades anesthetized him with
brandy — Kemp went on to be a war lover, seeking out danger anywhere he could find it.
This remarkable man seems to have sunk without trace. So has his book. I read it twenty years ago, but in a library copy. Thinking I'd like to read it again, I went to Abebooks.com, which has everything. The only copy of Mine Were of Trouble on Abebooks was a Spanish translation. Kemp gets a passing mention in A.N. Wilson's After the Victorians, but has otherwise disappeared down the memory hole. What a pity. He was not, by the way, a fascist. In his book he described himself as a "royalist" and the forces he was fighting with as "Carlists." He fought bravely on the Allied side in WW2. Later he fought with the French against the Vietminh. The man just liked fighting — a true war lover. Somehow he survived it all. Now he's forgotten. What a pity.
I didn't know the half of it. Footnote, supplied by a reader:
Dear Mr. Derbyshire: Nothing's down the memory hole in the 21st Century Anglosphere. Far from disappearing, the remarkable Peter Kemp you mentioned in your column a few days ago seems to have lived a full and astonishing life.
• From the Times obituary, November 7, 1993:
Peter Kemp, DSO, MC, author, soldier and war reporter, died on October 30 aged 78. He was born in Bombay on August 19, 1915. Peter Kemo was in many ways a throwback to an earlier era. He followed the career of what used to be called "a soldier of fortune" if latterly under the convenient disguise of a war reporter but, in fact, he was a deeply committed reactionary who believed in bringing his convictions to the life of action. He made an early start at that when at the age of 21 he joined the Franco side in the Spanish Civil War.
He first saw fighting on the outskirts of Madrid, taking part in street battles against Republican troops who were only a few yards away, before a chance meeting with General Millan Astray the "Father" of the Spanish Foreign Legion led to his being offered command of his own platoon in that elite corps (an unusual distinction for a non-Spaniard). Having been several times wounded, he was put out of action in the summer of 1938 by a mortar bomb which shattered his jaw.
Back in London, he ran into an old acquaintance from Spain, Douglas Dodds-Parker (later Conservative MP for Banbury). This led to his being recruited into MI(R) a forerunner of the Special Operations Executive under whose aegis he again was allowed to assume the mantle of a military adventurer.
During the second world war he took part in a variety of cloak-and-dagger enterprises leading raids on German-held lighthouses and signal-stations around the Channel Islands, parachuting into Albania (where he found himself giving military aid to Enver Hoxha, the communist leader) vainly trying to save Poland for the West and finally intervening on behalf of the French in Indochina and of the Dutch in Indonesia. He was awarded the MC in 1941 and the DSO in 1945.
Peter Mant McIntyre Kemp was born with a conventional enough background as a son of the Empire. His early years were spent in India where his father was judge of the High Court of Bombay and not, as Kemp himself used to like to claim, the Chief Justice. Sent back to England to be educated at an early age as all children of the Raj were he went first to a prep school in Sussex, then to Wellington and finally to Trinity College, Cambridge, where he gloried in what he called his "unfashionable Tory faith." His original intention had been to follow in his father's footsteps by reading for the Bar but the outbreak of the Spanish Civil War in July 1936 diverted him from that path for ever.
Permitted to follow his own inclinations, Kemp would certainly have elected to stay in the Army after the war but the tuberculosis that he had contracted in the Far East led to his being invalided out. His health never quite recovered and he was forced to find work selling insurance for Imperial Life, only retiring in 1980. The company was unusually tolerant of his wanderlust and, provided he brought them in business over the course of a year, made no objections to his various forays.
So it was that, unable to fight, Kemp built up a parallel career as a war reporter and trouble-shooter. He went to Hungary in 1956 to cover the Soviet invasion, nominally as The Tablet's correspondent, and in 1965 was sent by the News of the World to Southeast Asia to write a series of articles on the theme of communist subversion in the region. He also made more than tourist's visits to Central and South America, Rhodesia and the Congo and towards the end of his life returned to Albania for The Sunday Telegraph. He wrote a number of vivid books about his exploits and experiences: Mine Were of Trouble (1957), No Colours or Crest (1958), Alms for Oblivion (1961) and his autobiography, The Thorns of Memory (1990).
He was twice married and twice divorced.
• And from the Independent obituary, November 4, 1993:
Peter Mant MacIntyre Kemp, soldier and writer: born Bombay 19 August 1915; MC 1941; DSO 1945; twice married (marriages dissolved); died London 30 October 1993.
Peter Kemp was a distinguished irregular soldier during the Second World War, and long retained his nose for trouble spots thereafter.
His father was a judge in Bombay, where he was born. After conventional education at Wellington and Trinity, Cambridge, he started to read for the Bar, but was called away by the outbreak of civil war in Spain. Already alarmed at the menace of Communism, he joined a Carlist unit in General Franco's forces in November 1936 and later transferred to the Spanish Foreign Legion in which — rare distinction for a non-Spaniard — he commanded a platoon. He was several times wounded, but stayed at duty till a mortar bomb broke his jaw in the summer of 1938.
He had barely recovered from this wound when a chance meeting with (Sir) Douglas Dodds-Parker brought him into MIR, a small research department of the War Office which was one of the starting components of the wartime Special Operations Executive. MIR sent him on an abortive expedition to Norway by submarine. He was one of the earliest pupils at the Combined Operations Training School at Lochailort on the shores of the Western Highlands; sailed in intense discomfort to Gibraltar in the hold of that dubious craft HMS Fidelity; and went on another abortive submarine voyage in pursuit of a German U-boat. This aborted because a British destroyer attacked the submarine carrying Kemp by mistake. The operation SOE had planned for him in Spain was cancelled. He returned to the United Kingdom for further training in parachuting sabotage and undercover tactics.
With a small-scale raiding force he took part in a few cross-channel commando raids, including a successful one which captured all seven of the crew of the Casquets lighthouse (one of them still wearing a hair-net). When the force closed down after its leader's death in action he went out to Cairo, and was absorbed into SOE's Albanian section. He spent 10 months clandestinely in Albania, many of them in disagreeable proximity to Enver Hoxha, the Communist leader. He had several close brushes with death, and found the complexities of Balkan politics intensely confusing in a many-sided war. Eventually he walked out into Montenegro, across the border with Yugoslavia, and was safely brought back to Cairo.
He did one more mission for SOE in Europe, into southern Poland at the end of 1944, in a party commanded by Colonel D.T. Hudson, who had been a leading SOE agent in Yugoslavia. Their Polish friends protected them from capture by the Germans. They were then overrun by the Red Army, and imprisoned in odious conditions for three weeks by the NKVD. Two months hanging about in Moscow waiting for an exit visa followed.
He had still not had enough fighting. He parachuted once more, in the summer of 1945, into Siam and ran arms to the French across the border with Laos — again fighting a polygonal war, for both the Japanese and the Viet Min tried to stop him.
Tuberculosis forced his retirement from the Army, and his health thereafter was always precarious. His energies remained enormous. He sold life insurance policies for a living, and wrote some excellent books. One, Mine Were of Trouble (1957) described his part in the war in Spain, and No Colours or Crest (1958), his life with MIR and SOE. These were strong, spare narratives, in beautifully clear English, extremely readable then and since. He acknowledged many of his own mistakes and never said a word of his calm, gentle, unfailing courage.
He went to Hungary during the rising in 1956, nominally as the Tablet's correspondent, and helped some students escape to Austria. He was present during the troubles in the Congo that led to its independence as Zaire; he fought intermittently in Vietnam; he visited and reported on revolutions in Central and in South America; he could even bear to revisit Albania, where he predicted further racial clashes between Albanians and Serbs. He was always ready to advise a friend; and in The Forms of Memory (1990) produced a notable autobiography. He bore his last illness with his usual fortitude.
Wonders of the Internet. I still, after all these years, occasionally get
a say-what? moment
when browsing the Internet. It happened the other day. I needed to look up something David Hume said, so I brought up
gutenberg.org, went to
"Authors," clicked on "H," and scanned down to the "Hu—"s. Whoa! "Human
Genome Project"? Yep, there's
the entire genetic code of a human being.
It sure makes compulsive reading. From Chromosome 17:
GAATTCTGGGAGATACAAGTCAAGTTGAGATTTCTGTGGGGACGCAGCCAAACCATATCA
CCTGGTTTCTCTGTGTTGCCCAGGCTAGTCTTGAACTCCTGGGCTCAAGCGATCTGCATG
CCTCGGTCCATCAAAATATTGGAATTACAGGCTTGAGCCACTGTGCCCGGCCTCTGCTGA
CCTTTTAAATAAAGCTTTGGCAAGTGACAGTTTGAGGTTAGGAACCATTGATAATTGATG
AATTACCGGATAAGTCTTTATTTCTTCCTTCTACATCTGATAATAAATCCGATGATTTCC
ATTTTCATGTCATTGCGCCTCTACTGTTAACATATAATTATTTATACTTTCTATTTTTTT
TTTTTTAACTCTTCCACTTTCTCTTTTTGTGGTGGGGTACTTACCCTAGCAATAAACACA …
I mean, we all know the thing has been done, I just didn't expect to find it on gutenberg.org in between John L. Hülshof (Reading Made Easy for Foreigners) and Alexander von Humboldt (A Sketch of the Physical Description of the Universe). You can't get away from biology nowadays.
Math Corner. Before the brainteasers, I just want to note the discovery on
September 6 of the 46th
known Mersenne prime number, with value 237,156,667 – 1. This was an unusual event because
the prime is out of sequence:
a bigger Mersenne prime had been discovered in August, value 243,112,609 – 1. If
you want to see these numbers
in their full glory, there are links here. Be warned, though; the dang things
have millions of digits.
[A Mersenne number is one that is equal to 2p – 1 for some prime number p. A Mersenne prime is a Mersenne number that is a prime number. Not all of them are: 211 – 1 factorizes as 23×89, so it's a Mersenne number but not a Mersenne prime. Nor, of course, is every prime a Mersenne prime: 5 is not.
There is a vast literature on Mersenne primes, with many neat results. Here is one of my own favorites: between any number and its double (say between one million and two million), how many primes p would you expect to find, on average, for which 2p – 1 is a Mersenne prime? Answer: eγ, where e is the famous base of natural logarithms 2.7182818284590452353… and γ is Euler's gamma 0.5772156649015328606…, about which Julian Havil wrote a very fine book. eγ works out to about 1.7810724179901979852… The actual number of p's between one million and two million is two, close to the expected value. Between two million and four million there are also two. Between four million and eight million, however, there is only one. The average for these three ranges is therefore 1.666…, which is even closer to the expected value.]
OK, the brainteasers. Just a couple of tiny ones this month.
[1] Take some whole number of more than one digit; e.g. the three-digit number 183. First double your number: 366. Now reverse your number's digits: 381. What is the absolute difference of those last two numbers (i.e. the bigger minus the smaller)? It's 15. Question: How small can this difference be? Can it ever be zero? If so, find an instance. If not, explain why not.
[2] One of Jonah's Timewasters, posted a while ago, was Drifts. A reader tells me the scoring system goes as follows: "You get more points the more balls you pick up, with 1 point for 3 greens, 5 for four greens, 11 for five, 17 for six, 25 for seven, etc. (The next few terms, for eight, nine, ten, … greens, are: 33, 41, 51, 61, 73, 85, 97, 111, 125, 141, 157, 173, 191, 209, 229, 249, 269, 291, 313, 337, 361, 385, 411, …) Once you get past that inital jump of 4 points (from 1 point for 3 greens to 5 points for 4), the jumps in number of points go: 6, 6, 8, 8, 8, 10, 10, 12, 12, 12, 14, 14, 16, 16, 16, …" Question: How many points do you get for n balls?
[Solutions here]